There was a new publication - Contemporary paternal genetic landscape of Polish and German populations: from early medieval Slavic expansion to post-World War II resettlements // European Journal of Human Genetics

Statistics on haplogroup I1.


Geographic locations of studied populations on an ethnolinguistic map of Central Europe in the early 20th century (Slavic and German-speaking areas are marked in green and red, respectively). 1 – Kaszuby; 2 – Kociewie; 3 – Kurpie; 4 – southern Polish pre-war population, studied by Woźniak et al.; 5 – Lusatia; 6 – western Slovakia (Bratislava region); 7 – Mecklenburg; 8 – western Bavaria (Augsburg region).
Statistics on haplogroup I1.

haplogroups have been detected in the studied sample set, including an insertion polymorphism at M91 (M91insT wish a stretch of 10 thymidines) previously observed in two individuals from a large woridwide sample set."
And probably for I1 found new SNP. I speak about SNP M91. Probably in this place there was insertion since M91 marks haplogroup B-T. About it probably also tells "M91insT" inscription.
And probably for I1 found new SNP. I speak about SNP M91. Probably in this place there was insertion since M91 marks haplogroup B-T. About it probably also tells "M91insT" inscription.
I think to representatives of all branches of I1 (Z58+, Z63+, L22+, M227+, DF29+, Z131+, M253+) it is necessary to check this SNP. While it is possible to tell that the branch doesn't have this new SNP Z382+.
http://abbey-roots.blogspot.ru/2012/09/new-publication-new-snp.html
| Name: | M91 |
|---|---|
| Type: | snp |
| Description: | |
| Source: | M |
| Position: | ChrY:20366926..20366926 (+ strand) |
| Length: | 1 |
| ISOGG_haplogroup: | BT |
| Mutation: | 8T to 9T |
| YCC_haplogroup: | Approx. hg: BT |
| allele_anc: | del |
| allele_der: | ins |
| comments: | Anc/Der reversed since 2011-12-08 |
| count_derived: | 377 |
| count_tested: | 436 |
| primer_f: | GAGCTTGGACTTTAGGACGG |
| primer_r: | AAACTTTAAGGCACTTCTGGC |
| primary_id: | 46372 |
| gbrowse_dbid: | ymap:database |